{ "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/7", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -177.655, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.928, "chi2": -130.116, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 30.394, "C1C1_dist": 11.605, "N1N9_dist": 9.632, "C6C8_dist": 9.182, "CNNC_torsion": -6.660, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.23],N2(amino)-N7[3.07]", "interBase_angle": 11.647, "planarity": 0.159, "simple_Shear": -2.968, "simple_Stretch": 2.880, "simple_Buckle": 0.692, "simple_Propeller": -11.627, "bp_simpleParams": [ -2.968, 2.880, 0.423, 0.692, -11.627, -89.503 ], "bp_params": [ 1.349, 3.909, 0.423, -10.238, -5.554, -89.341 ], "frame": { "rmsd": null, "origin": [ 11.705, -16.700, 7.976 ], "x_axis": [ -0.449, 0.894, -0.006 ], "y_axis": [ 0.568, 0.290, 0.770 ], "z_axis": [ 0.690, 0.343, -0.638 ], "quaternion": [ 0.226, 0.474, 0.771, 0.361 ] } }, { "index": 2, "nt1": "///A/1", "nt2": "///A/19", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -177.655, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 29.513, "chi2": -130.592, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.030, "C1C1_dist": 12.002, "N1N9_dist": 10.068, "C6C8_dist": 9.694, "CNNC_torsion": 20.897, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.40],O6(carbonyl)-N1(imino)[3.44]", "interBase_angle": 9.690, "planarity": 0.170, "simple_Shear": -2.813, "simple_Stretch": 3.232, "simple_Buckle": -9.596, "simple_Propeller": -1.348, "bp_simpleParams": [ -2.813, 3.232, 0.614, -9.596, -1.348, 90.126 ], "bp_params": [ -1.854, -3.862, 0.614, 5.034, -8.280, 90.220 ], "frame": { "rmsd": null, "origin": [ 11.068, -14.094, 8.800 ], "x_axis": [ -0.557, -0.281, -0.781 ], "y_axis": [ -0.444, 0.896, -0.005 ], "z_axis": [ 0.702, 0.344, -0.624 ], "quaternion": [ 0.423, -0.207, 0.877, 0.096 ] } }, { "index": 3, "nt1": "///A/2", "nt2": "///A/8", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -157.325, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.306, "chi2": -101.643, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 29.598, "C1C1_dist": 11.475, "N1N9_dist": 9.593, "C6C8_dist": 9.243, "CNNC_torsion": -0.251, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.03],N2(amino)-N7[2.82]", "interBase_angle": 3.837, "planarity": 0.060, "simple_Shear": -2.616, "simple_Stretch": 3.006, "simple_Buckle": -1.336, "simple_Propeller": -3.597, "bp_simpleParams": [ -2.616, 3.006, 0.222, -1.336, -3.597, -86.023 ], "bp_params": [ 1.777, 3.567, 0.222, -3.835, -0.141, -85.991 ], "frame": { "rmsd": null, "origin": [ 13.018, -15.888, 4.884 ], "x_axis": [ -0.074, 0.892, 0.445 ], "y_axis": [ 0.771, -0.231, 0.593 ], "z_axis": [ 0.632, 0.387, -0.671 ], "quaternion": [ 0.076, 0.676, 0.615, 0.398 ] } }, { "index": 4, "nt1": "///A/2", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -157.325, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 26.251, "chi2": -98.038, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.173, "C1C1_dist": 11.642, "N1N9_dist": 9.655, "C6C8_dist": 9.311, "CNNC_torsion": 1.325, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.93],O6(carbonyl)-N1(imino)[2.84]", "interBase_angle": 3.782, "planarity": 0.063, "simple_Shear": -2.644, "simple_Stretch": 2.656, "simple_Buckle": 1.676, "simple_Propeller": 3.391, "bp_simpleParams": [ -2.644, 2.656, 0.278, 1.676, 3.391, 92.485 ], "bp_params": [ -1.508, -3.431, 0.278, -3.768, 0.322, 92.455 ], "frame": { "rmsd": null, "origin": [ 13.669, -13.773, 6.633 ], "x_axis": [ -0.749, 0.257, -0.611 ], "y_axis": [ -0.042, 0.901, 0.431 ], "z_axis": [ 0.662, 0.348, -0.664 ], "quaternion": [ 0.350, 0.059, 0.910, 0.214 ] } }, { "index": 5, "nt1": "///A/3", "nt2": "///A/9", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -127.027, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.894, "chi2": -99.762, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 29.201, "C1C1_dist": 11.505, "N1N9_dist": 9.588, "C6C8_dist": 9.254, "CNNC_torsion": -3.217, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.99],N2(amino)-N7[2.84]", "interBase_angle": 12.336, "planarity": 0.174, "simple_Shear": -2.622, "simple_Stretch": 2.932, "simple_Buckle": 9.880, "simple_Propeller": 7.388, "bp_simpleParams": [ -2.622, 2.932, -0.131, 9.880, 7.388, -87.347 ], "bp_params": [ 1.726, 3.535, -0.131, 10.567, -6.366, -87.191 ], "frame": { "rmsd": null, "origin": [ 14.499, -14.806, 2.313 ], "x_axis": [ 0.214, 0.673, 0.708 ], "y_axis": [ 0.784, -0.551, 0.287 ], "z_axis": [ 0.583, 0.493, -0.645 ], "quaternion": [ -0.066, 0.776, 0.469, 0.416 ] } }, { "index": 6, "nt1": "///A/3", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -127.027, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 30.438, "chi2": -90.950, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.700, "C1C1_dist": 11.636, "N1N9_dist": 9.756, "C6C8_dist": 9.459, "CNNC_torsion": -26.248, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.04],O6(carbonyl)-N1(imino)[3.03]", "interBase_angle": 18.114, "planarity": 0.246, "simple_Shear": -2.579, "simple_Stretch": 2.980, "simple_Buckle": 17.193, "simple_Propeller": 5.700, "bp_simpleParams": [ -2.579, 2.980, 0.024, 17.193, 5.700, 89.728 ], "bp_params": [ -1.847, -3.481, 0.024, -11.495, 13.999, 89.867 ], "frame": { "rmsd": null, "origin": [ 15.873, -13.430, 4.258 ], "x_axis": [ -0.762, 0.576, -0.296 ], "y_axis": [ 0.318, 0.732, 0.603 ], "z_axis": [ 0.564, 0.365, -0.741 ], "quaternion": [ 0.239, 0.249, 0.899, 0.269 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/13", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -130.116, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.226, "chi2": -113.449, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.949, "C1C1_dist": 11.621, "N1N9_dist": 9.649, "C6C8_dist": 9.305, "CNNC_torsion": -24.497, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.94]", "interBase_angle": 13.892, "planarity": 0.193, "simple_Shear": -2.620, "simple_Stretch": 2.718, "simple_Buckle": 12.232, "simple_Propeller": -6.585, "bp_simpleParams": [ -2.620, 2.718, 0.448, 12.232, -6.585, -91.607 ], "bp_params": [ 1.569, 3.434, 0.448, -1.628, -13.796, -92.017 ], "frame": { "rmsd": null, "origin": [ 9.337, -16.739, 6.204 ], "x_axis": [ 0.554, 0.265, 0.789 ], "y_axis": [ 0.482, -0.875, -0.045 ], "z_axis": [ 0.679, 0.406, -0.612 ], "quaternion": [ -0.129, 0.872, 0.214, 0.421 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/14", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -101.643, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.972, "chi2": -144.789, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.898, "C1C1_dist": 11.956, "N1N9_dist": 9.927, "C6C8_dist": 9.567, "CNNC_torsion": -0.497, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.01],N2(amino)-N7[3.25]", "interBase_angle": 4.788, "planarity": 0.075, "simple_Shear": -2.731, "simple_Stretch": 2.798, "simple_Buckle": 2.858, "simple_Propeller": -3.841, "bp_simpleParams": [ -2.731, 2.798, -0.085, 2.858, -3.841, -94.765 ], "bp_params": [ 1.586, 3.574, -0.085, -2.509, -4.078, -94.787 ], "frame": { "rmsd": null, "origin": [ 10.906, -14.529, 3.839 ], "x_axis": [ 0.770, -0.239, 0.591 ], "y_axis": [ 0.083, -0.882, -0.465 ], "z_axis": [ 0.632, 0.407, -0.659 ], "quaternion": [ -0.239, 0.910, -0.043, 0.336 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/15", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -99.762, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.535, "chi2": -111.779, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 28.426, "C1C1_dist": 11.490, "N1N9_dist": 9.580, "C6C8_dist": 9.290, "CNNC_torsion": -23.422, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.92],N2(amino)-N7[2.88]", "interBase_angle": 19.735, "planarity": 0.266, "simple_Shear": -2.526, "simple_Stretch": 2.866, "simple_Buckle": 19.709, "simple_Propeller": 1.003, "bp_simpleParams": [ -2.526, 2.866, 0.170, 19.709, 1.003, -88.682 ], "bp_params": [ 1.772, 3.384, 0.170, 7.981, -18.049, -89.256 ], "frame": { "rmsd": null, "origin": [ 12.703, -12.671, 1.964 ], "x_axis": [ 0.619, -0.639, 0.456 ], "y_axis": [ -0.206, -0.693, -0.691 ], "z_axis": [ 0.758, 0.334, -0.561 ], "quaternion": [ -0.302, 0.847, -0.249, 0.358 ] } }, { "index": 10, "nt1": "///A/13", "nt2": "///A/19", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -113.449, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.396, "chi2": -130.592, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.897, "C1C1_dist": 11.628, "N1N9_dist": 9.735, "C6C8_dist": 9.406, "CNNC_torsion": 2.193, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.06],N2(amino)-N7[2.99]", "interBase_angle": 11.999, "planarity": 0.197, "simple_Shear": -2.598, "simple_Stretch": 3.007, "simple_Buckle": 6.366, "simple_Propeller": 10.171, "bp_simpleParams": [ -2.598, 3.007, -0.742, 6.366, 10.171, -88.580 ], "bp_params": [ 1.828, 3.528, -0.742, 11.808, -2.131, -88.285 ], "frame": { "rmsd": null, "origin": [ 8.701, -14.133, 7.028 ], "x_axis": [ 0.478, -0.877, -0.045 ], "y_axis": [ -0.543, -0.255, -0.800 ], "z_axis": [ 0.690, 0.406, -0.599 ], "quaternion": [ -0.395, 0.764, -0.465, 0.211 ] } }, { "index": 11, "nt1": "///A/14", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -144.789, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.972, "chi2": -98.038, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 29.887, "C1C1_dist": 11.501, "N1N9_dist": 9.616, "C6C8_dist": 9.250, "CNNC_torsion": 3.144, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.06],N2(amino)-N7[2.91]", "interBase_angle": 6.393, "planarity": 0.109, "simple_Shear": -2.664, "simple_Stretch": 2.998, "simple_Buckle": 5.834, "simple_Propeller": -2.614, "bp_simpleParams": [ -2.664, 2.998, -0.229, 5.834, -2.614, -86.575 ], "bp_params": [ 1.729, 3.619, -0.229, -0.144, -6.391, -86.664 ], "frame": { "rmsd": null, "origin": [ 11.557, -12.414, 5.588 ], "x_axis": [ 0.051, -0.891, -0.451 ], "y_axis": [ -0.748, 0.265, -0.609 ], "z_axis": [ 0.662, 0.368, -0.653 ], "quaternion": [ 0.407, -0.600, 0.683, -0.088 ] } }, { "index": 12, "nt1": "///A/15", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -111.779, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.352, "chi2": -90.950, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.863, "C1C1_dist": 11.682, "N1N9_dist": 9.772, "C6C8_dist": 9.479, "CNNC_torsion": -1.803, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[3.05],N2(amino)-N7[3.07]", "interBase_angle": 17.978, "planarity": 0.273, "simple_Shear": -2.552, "simple_Stretch": 3.030, "simple_Buckle": 14.767, "simple_Propeller": 10.255, "bp_simpleParams": [ -2.552, 3.030, -0.793, 14.767, 10.255, -89.415 ], "bp_params": [ 1.913, 3.469, -0.793, 14.856, -10.125, -89.156 ], "frame": { "rmsd": null, "origin": [ 14.078, -11.295, 3.910 ], "x_axis": [ -0.324, -0.737, -0.593 ], "y_axis": [ -0.599, 0.645, -0.475 ], "z_axis": [ 0.733, 0.202, -0.650 ], "quaternion": [ 0.410, -0.413, 0.809, -0.084 ] } } ], "num_multiplets": 3, "multiplets": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/1,///A/7,///A/13,///A/19", "planarity": 0.201 }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2,///A/8,///A/14,///A/20", "planarity": 0.095 }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/9,///A/15,///A/21", "planarity": 0.337 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 0, "strand1": "GGG", "strand2": "GGG", "bp_type": "...", "helix_form": "..", "helical_rise": 3.850, "helical_rise_std": 0.312, "helical_radius": 11.320, "helical_radius_std": 0.961, "helical_axis": [ 0.589, 0.333, -0.736 ], "point1": [ 10.279, -15.832, 7.984 ], "point2": [ 14.954, -13.191, 2.143 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/7", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.349, 3.909, 0.423, -10.238, -5.554, -89.341 ], "step_params": [ -0.342, -1.285, 3.191, 3.605, 2.854, 33.972 ], "heli_params": [ -2.609, 1.120, 3.025, 4.857, -6.134, 34.272 ], "bp2_params": [ 1.777, 3.567, 0.222, -3.835, -0.141, -85.991 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.191, "simple_Twist": 31.590, "simple_hRise": 3.009, "simple_hTwist": 31.914 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/8", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.777, 3.567, 0.222, -3.835, -0.141, -85.991 ], "step_params": [ -0.570, -0.447, 3.074, 4.021, 5.544, 25.264 ], "heli_params": [ -2.362, 2.255, 2.791, 12.387, -8.983, 26.162 ], "bp2_params": [ 1.726, 3.535, -0.131, 10.567, -6.366, -87.191 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.074, "simple_Twist": 25.085, "simple_hRise": 2.788, "simple_hTwist": 25.989 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/9", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M" } ] }, { "index": 2, "num_stems": 0, "strand1": "GGG", "strand2": "GGG", "bp_type": "...", "helix_form": "..", "helical_rise": 3.938, "helical_rise_std": 0.502, "helical_radius": 10.463, "helical_radius_std": 0.979, "helical_axis": [ 0.610, 0.534, -0.585 ], "point1": [ 9.534, -15.343, 5.884 ], "point2": [ 14.407, -11.083, 1.213 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/13", "nt2": "///A/19", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.828, 3.528, -0.742, 11.808, -2.131, -88.285 ], "step_params": [ -0.395, -0.883, 3.500, -3.366, 2.390, 34.196 ], "heli_params": [ -1.888, 0.108, 3.454, 4.046, 5.699, 34.437 ], "bp2_params": [ 1.729, 3.619, -0.229, -0.144, -6.391, -86.664 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.500, "simple_Twist": 35.054, "simple_hRise": 3.456, "simple_hTwist": 35.288 }, { "index": 2, "nt1": "///A/14", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.729, 3.619, -0.229, -0.144, -6.391, -86.664 ], "step_params": [ -0.430, -0.327, 3.183, 7.340, 7.340, 23.773 ], "heli_params": [ -2.644, 2.872, 2.713, 16.828, -16.828, 25.910 ], "bp2_params": [ 1.913, 3.469, -0.793, 14.856, -10.125, -89.156 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.183, "simple_Twist": 22.390, "simple_hRise": 2.672, "simple_hTwist": 24.652 }, { "index": 3, "nt1": "///A/15", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M" } ] } ], "num_stacks": 7, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TA", "nts_long": "///A/4,///A/6" }, { "index": 2, "num_nts": 2, "nts_short": "TA", "nts_long": "///A/11,///A/12" }, { "index": 3, "num_nts": 2, "nts_short": "TA", "nts_long": "///A/17,///A/18" }, { "index": 4, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/1,///A/2,///A/3" }, { "index": 5, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/7,///A/8,///A/9" }, { "index": 6, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/13,///A/14,///A/15" }, { "index": 7, "num_nts": 3, "nts_short": "GGG", "nts_long": "///A/19,///A/20,///A/21" } ], "nonStack": { "num_nts": 2, "nts_short": "TT", "nts_long": "///A/10,///A/16" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/104/NBM", "nt": "///A/3", "vert_dist": 3.276 }, { "index": 2, "type": "other", "atom": "///A/104/NBN", "nt": "///A/9", "vert_dist": 3.255 } ], "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 21, "nts_short": "GGGTTAGGGTTAGGGTTAGGG", "nts_long": "///A/1,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21" } ], "num_Gtetrads": 3, "Gtetrads": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/1,///A/7,///A/13,///A/19", "planarity": 0.201, "G1G2_simpleParams": [ -2.968, 2.880, 0.423, 0.692, -11.627, -89.503 ], "G2G3_simpleParams": [ -2.620, 2.718, 0.448, 12.232, -6.585, -91.607 ], "G3G4_simpleParams": [ -2.598, 3.007, -0.742, 6.366, 10.171, -88.580 ], "G4G1_simpleParams": [ -2.813, 3.232, -0.614, -9.596, -1.348, -90.126 ], "type": "other", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "3---", "groove_type": "----", "groove_distPP": [ null, 20.249, 14.688, null ], "rmsd": 0.187, "frame": { "rmsd": null, "origin": [ 10.252, -15.359, 7.448 ], "x_axis": [ -0.723, 0.327, -0.609 ], "y_axis": [ -0.026, 0.867, 0.497 ], "z_axis": [ 0.691, 0.375, -0.619 ], "quaternion": [ 0.363, 0.084, 0.896, 0.243 ] } }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2,///A/8,///A/14,///A/20", "planarity": 0.095, "G1G2_simpleParams": [ -2.616, 3.006, 0.222, -1.336, -3.597, -86.023 ], "G2G3_simpleParams": [ -2.731, 2.798, -0.085, 2.858, -3.841, -94.765 ], "G3G4_simpleParams": [ -2.664, 2.998, -0.229, 5.834, -2.614, -86.575 ], "G4G1_simpleParams": [ -2.644, 2.656, -0.278, 1.676, 3.391, -92.485 ], "type": "planar", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "3-3-", "groove_type": "----", "groove_distPP": [ 16.233, 15.456, 16.191, 14.707 ], "rmsd": 0.163, "frame": { "rmsd": null, "origin": [ 12.351, -14.109, 5.200 ], "x_axis": [ -0.643, 0.737, -0.208 ], "y_axis": [ 0.410, 0.560, 0.720 ], "z_axis": [ 0.647, 0.378, -0.662 ], "quaternion": [ 0.253, 0.339, 0.846, 0.324 ] } }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/9,///A/15,///A/21", "planarity": 0.337, "G1G2_simpleParams": [ -2.622, 2.932, -0.131, 9.880, 7.388, -87.347 ], "G2G3_simpleParams": [ -2.526, 2.866, 0.170, 19.709, 1.003, -88.682 ], "G3G4_simpleParams": [ -2.552, 3.030, -0.793, 14.767, 10.255, -89.415 ], "G4G1_simpleParams": [ -2.579, 2.980, -0.024, 17.193, 5.700, -89.728 ], "type": "bowl", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "----", "groove_type": "----", "groove_distPP": [ 16.710, 15.417, 16.929, 14.848 ], "rmsd": 0.170, "frame": { "rmsd": null, "origin": [ 14.682, -12.873, 2.733 ], "x_axis": [ -0.404, 0.911, 0.080 ], "y_axis": [ 0.627, 0.212, 0.750 ], "z_axis": [ 0.667, 0.353, -0.657 ], "quaternion": [ 0.195, 0.510, 0.754, 0.366 ] } } ], "num_splayUnits": 5, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/6,///A/7" }, { "index": 2, "num_nts": 3, "nts_short": "GTT", "nts_long": "///A/9,///A/10,///A/11" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/12,///A/13" }, { "index": 4, "num_nts": 2, "nts_short": "GT", "nts_long": "///A/15,///A/16" }, { "index": 5, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/18,///A/19" } ], "dbn": { "all_chains": { "num_nts": 21, "num_chars": 21, "bseq": "GGGTTAGGGTTAGGGTTAGGG", "sstr": ".....................", "form": "AA..A..............B-" }, "chain_A": { "num_nts": 21, "num_chars": 21, "bseq": "GGGTTAGGGTTAGGGTTAGGG", "sstr": ".....................", "form": "AA..A..............B-" } }, "chains": { "chain_A": { "num_nts": 21, "bseq": "GGGTTAGGGTTAGGGTTAGGG", "sstr": ".....................", "form": "AA..A..............B-", "helical_rise": 0.216, "helical_rise_std": 3.607, "helical_axis": [ 0.794, 0.602, 0.079 ], "point1": [ 18.493, -15.248, -1.494 ], "point2": [ 22.050, -12.550, -1.140 ], "num_chars": 61, "suite": "G1aG1bG!!T!!T1bA2oG!!G!!G!!T6pT!!A!!G!!G1bG!!T!!T!!A6pG!!G!!G" } }, "num_nts": 21, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": null, "beta": null, "gamma": -138.044, "delta": 104.784, "epsilon": -132.119, "zeta": -69.167, "epsilon_zeta": -62.952, "bb_type": "BI", "chi": -177.655, "glyco_bond": "anti", "C5prime_xyz": [ -0.615, 7.683, 1.664 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.629, "Dp": 4.654, "splay_angle": 22.142, "splay_distance": 3.538, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 26.203, "v1": -34.530, "v2": 29.438, "v3": -14.812, "v4": -7.032, "amplitude": 34.097, "phase_angle": 329.695, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 12.658, -15.458, 9.344 ], "x_axis": [ -0.648, 0.464, -0.604 ], "y_axis": [ 0.067, 0.825, 0.562 ], "z_axis": [ 0.759, 0.324, -0.565 ], "quaternion": [ 0.391, 0.152, 0.871, 0.254 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -65.626, "beta": 176.267, "gamma": 46.872, "delta": 92.951, "epsilon": -159.411, "zeta": -91.530, "epsilon_zeta": -67.881, "bb_type": "BI", "chi": -157.325, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.781, 0.327 ], "P_xyz": [ 1.148, 9.274, 0.855 ], "form": "A", "ssZp": 4.115, "Dp": 4.300, "splay_angle": 20.415, "splay_distance": 3.240, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 159.131, "theta": -157.231, "eta_prime": -176.416, "theta_prime": -149.365, "eta_base": -137.291, "theta_base": -136.000, "v0": 0.263, "v1": -21.212, "v2": 32.613, "v3": -33.050, "v4": 20.843, "amplitude": 34.272, "phase_angle": 17.899, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.036, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 14.397, -15.465, 6.262 ], "x_axis": [ -0.565, 0.820, -0.095 ], "y_axis": [ 0.498, 0.430, 0.753 ], "z_axis": [ 0.658, 0.378, -0.651 ], "quaternion": [ 0.231, 0.405, 0.813, 0.348 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,phosphate", "alpha": -43.214, "beta": 170.234, "gamma": 51.021, "delta": 149.955, "epsilon": -126.759, "zeta": 60.085, "epsilon_zeta": 173.155, "bb_type": "--", "chi": -127.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.778, 8.653, -0.852 ], "P_xyz": [ 0.689, 9.121, -0.085 ], "form": ".", "ssZp": 1.749, "Dp": 1.539, "splay_angle": 81.442, "splay_distance": 12.707, "splay_ratio": 0.653, "d22": null, "d64": null, "eta": -173.281, "theta": 91.319, "eta_prime": -144.736, "theta_prime": 50.038, "eta_base": -130.753, "theta_base": 20.757, "v0": -21.988, "v1": 35.721, "v2": -35.238, "v3": 23.150, "v4": -0.807, "amplitude": 36.905, "phase_angle": 162.713, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.460, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 16.030, -15.231, 3.473 ], "x_axis": [ -0.398, 0.856, 0.330 ], "y_axis": [ 0.772, 0.118, 0.625 ], "z_axis": [ 0.496, 0.504, -0.707 ], "quaternion": [ 0.056, 0.546, 0.746, 0.378 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": 92.153, "beta": -166.438, "gamma": 177.554, "delta": 127.148, "epsilon": -119.022, "zeta": -84.813, "epsilon_zeta": -34.210, "bb_type": "--", "chi": -94.814, "glyco_bond": "anti", "C5prime_xyz": [ -3.292, 7.782, -2.403 ], "P_xyz": [ -2.711, 7.730, -4.943 ], "form": ".", "ssZp": 1.180, "Dp": 1.347, "splay_angle": 43.482, "splay_distance": 7.253, "splay_ratio": 0.375, "d22": 6.277, "d64": 6.323, "eta": 159.826, "theta": -110.284, "eta_prime": 161.419, "theta_prime": -144.363, "eta_base": 151.822, "theta_base": -154.021, "v0": -34.655, "v1": 39.287, "v2": -29.108, "v3": 9.823, "v4": 15.369, "amplitude": 38.915, "phase_angle": 138.418, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 23.245, -14.816, 13.925 ], "x_axis": [ -0.991, -0.076, 0.113 ], "y_axis": [ 0.001, -0.833, -0.554 ], "z_axis": [ 0.136, -0.548, 0.825 ], "quaternion": [ -0.020, 0.065, -0.288, 0.955 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 131.768, "beta": -162.094, "gamma": 78.084, "delta": 78.375, "epsilon": -133.850, "zeta": -69.219, "epsilon_zeta": -64.631, "bb_type": "BI", "chi": -166.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.693, 0.888 ], "P_xyz": [ 1.090, 8.929, 1.210 ], "form": "A", "ssZp": 4.436, "Dp": 4.651, "splay_angle": 25.081, "splay_distance": 4.092, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 30.085, "theta": -131.840, "eta_prime": 72.949, "theta_prime": -124.384, "eta_base": 95.894, "theta_base": -97.898, "v0": -0.793, "v1": -23.824, "v2": 37.930, "v3": -39.251, "v4": 25.232, "amplitude": 40.250, "phase_angle": 19.549, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 25.274, -20.670, 17.694 ], "x_axis": [ 0.314, 0.939, -0.143 ], "y_axis": [ 0.502, -0.292, -0.814 ], "z_axis": [ -0.806, 0.183, -0.563 ], "quaternion": [ -0.339, 0.736, 0.489, -0.322 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -61.299, "beta": -172.078, "gamma": 54.926, "delta": 141.713, "epsilon": -84.126, "zeta": -82.374, "epsilon_zeta": -1.752, "bb_type": "--", "chi": -146.574, "glyco_bond": "anti", "C5prime_xyz": [ -1.860, 8.777, 0.009 ], "P_xyz": [ 0.199, 9.514, 1.477 ], "form": ".", "ssZp": 0.937, "Dp": 0.836, "splay_angle": 89.879, "splay_distance": 15.423, "splay_ratio": 0.709, "d22": null, "d64": null, "eta": -163.389, "theta": -48.764, "eta_prime": -138.380, "theta_prime": -96.682, "eta_base": -106.660, "theta_base": -115.614, "v0": -27.264, "v1": 37.436, "v2": -32.803, "v3": 17.852, "v4": 5.744, "amplitude": 36.987, "phase_angle": 152.484, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.823, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 22.868, -17.743, 16.150 ], "x_axis": [ 0.952, 0.287, -0.106 ], "y_axis": [ 0.185, -0.815, -0.550 ], "z_axis": [ -0.244, 0.504, -0.829 ], "quaternion": [ -0.278, 0.948, 0.125, -0.092 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": -63.591, "beta": -160.145, "gamma": -69.633, "delta": 131.554, "epsilon": -175.793, "zeta": -99.149, "epsilon_zeta": -76.644, "bb_type": "BI", "chi": -130.116, "glyco_bond": "anti", "C5prime_xyz": [ -2.394, 8.766, -1.031 ], "P_xyz": [ -2.969, 11.273, -1.639 ], "form": ".", "ssZp": 2.207, "Dp": 2.326, "splay_angle": 21.115, "splay_distance": 3.617, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 67.073, "theta": 161.615, "eta_prime": 109.197, "theta_prime": -179.573, "eta_base": 124.487, "theta_base": -146.507, "v0": -33.094, "v1": 37.426, "v2": -27.475, "v3": 9.086, "v4": 14.826, "amplitude": 36.997, "phase_angle": 137.954, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "2o", "suiteness": 0.168, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 10.752, -17.943, 6.609 ], "x_axis": [ 0.098, 0.849, 0.519 ], "y_axis": [ 0.783, -0.388, 0.486 ], "z_axis": [ 0.614, 0.358, -0.703 ], "quaternion": [ 0.043, 0.740, 0.552, 0.383 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -64.541, "beta": -154.907, "gamma": 32.317, "delta": 142.565, "epsilon": -177.254, "zeta": -99.749, "epsilon_zeta": -77.504, "bb_type": "BI", "chi": -101.643, "glyco_bond": "anti", "C5prime_xyz": [ -2.107, 8.128, -2.080 ], "P_xyz": [ -0.275, 9.919, -1.435 ], "form": ".", "ssZp": 1.730, "Dp": 1.830, "splay_angle": 18.924, "splay_distance": 3.321, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 171.438, "theta": -143.006, "eta_prime": -169.006, "theta_prime": -152.598, "eta_base": -135.950, "theta_base": -127.803, "v0": -17.543, "v1": 31.162, "v2": -32.364, "v3": 22.860, "v4": -3.471, "amplitude": 33.170, "phase_angle": 167.340, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 11.639, -16.311, 3.506 ], "x_axis": [ 0.485, 0.503, 0.715 ], "y_axis": [ 0.630, -0.768, 0.113 ], "z_axis": [ 0.606, 0.396, -0.690 ], "quaternion": [ -0.082, 0.858, 0.331, 0.385 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,splayed-apart", "alpha": -62.871, "beta": -177.907, "gamma": 33.822, "delta": 135.722, "epsilon": -147.123, "zeta": 65.340, "epsilon_zeta": 147.536, "bb_type": "--", "chi": -99.762, "glyco_bond": "anti", "C5prime_xyz": [ -2.710, 8.087, -2.304 ], "P_xyz": [ -0.817, 9.922, -2.367 ], "form": ".", "ssZp": 1.720, "Dp": 1.946, "splay_angle": 123.169, "splay_distance": 14.649, "splay_ratio": 0.885, "d22": null, "d64": null, "eta": 169.524, "theta": 64.388, "eta_prime": -174.079, "theta_prime": 18.875, "eta_base": -145.036, "theta_base": -158.399, "v0": -30.615, "v1": 37.972, "v2": -31.001, "v3": 13.855, "v4": 10.258, "amplitude": 37.510, "phase_angle": 145.739, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 12.967, -14.382, 1.152 ], "x_axis": [ 0.630, 0.058, 0.774 ], "y_axis": [ 0.402, -0.877, -0.262 ], "z_axis": [ 0.664, 0.477, -0.576 ], "quaternion": [ -0.211, 0.878, 0.131, 0.409 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 84.465, "beta": 141.727, "gamma": 28.140, "delta": 138.500, "epsilon": -93.820, "zeta": 85.412, "epsilon_zeta": 180.768, "bb_type": "--", "chi": 52.912, "glyco_bond": "syn", "C5prime_xyz": [ -5.675, 4.532, 1.079 ], "P_xyz": [ -6.273, 2.196, -0.007 ], "form": ".", "ssZp": -0.776, "Dp": 1.159, "splay_angle": 158.479, "splay_distance": 19.137, "splay_ratio": 0.982, "d22": 11.485, "d64": 14.818, "eta": -52.721, "theta": 132.599, "eta_prime": -3.834, "theta_prime": 92.327, "eta_base": 175.420, "theta_base": 84.595, "v0": -31.779, "v1": 42.026, "v2": -35.424, "v3": 18.213, "v4": 8.157, "amplitude": 41.035, "phase_angle": 149.684, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 15.487, -19.341, -12.400 ], "x_axis": [ 0.193, -0.079, -0.978 ], "y_axis": [ -0.130, -0.990, 0.055 ], "z_axis": [ -0.972, 0.117, -0.202 ], "quaternion": [ -0.020, 0.772, -0.068, -0.631 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 37.659, "beta": 162.917, "gamma": 71.714, "delta": 140.010, "epsilon": -118.192, "zeta": -73.758, "epsilon_zeta": -44.433, "bb_type": "--", "chi": -117.796, "glyco_bond": "anti", "C5prime_xyz": [ -2.015, 8.522, -1.373 ], "P_xyz": [ 0.551, 9.009, -1.233 ], "form": ".", "ssZp": 0.844, "Dp": 1.138, "splay_angle": 23.770, "splay_distance": 4.097, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -28.098, "theta": -91.817, "eta_prime": -18.600, "theta_prime": -130.037, "eta_base": -9.246, "theta_base": -142.251, "v0": -22.131, "v1": 34.779, "v2": -33.883, "v3": 21.688, "v4": 0.082, "amplitude": 35.772, "phase_angle": 161.297, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.184, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 9.577, -34.377, -2.142 ], "x_axis": [ 0.874, -0.224, 0.431 ], "y_axis": [ 0.406, 0.824, -0.396 ], "z_axis": [ -0.266, 0.521, 0.811 ], "quaternion": [ 0.937, -0.245, -0.186, -0.168 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -133.999, "beta": 128.475, "gamma": 109.710, "delta": 106.886, "epsilon": -121.313, "zeta": -41.245, "epsilon_zeta": -80.069, "bb_type": "--", "chi": -114.813, "glyco_bond": "anti", "C5prime_xyz": [ -3.599, 8.166, -1.907 ], "P_xyz": [ -2.515, 8.117, -4.317 ], "form": ".", "ssZp": 2.034, "Dp": 2.067, "splay_angle": 111.800, "splay_distance": 18.034, "splay_ratio": 0.829, "d22": null, "d64": null, "eta": 140.413, "theta": -76.420, "eta_prime": 163.635, "theta_prime": -106.773, "eta_base": 160.372, "theta_base": -122.795, "v0": -44.815, "v1": 35.964, "v2": -13.699, "v3": -12.007, "v4": 35.587, "amplitude": 43.903, "phase_angle": 108.182, "puckering": "C1'-exo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 6.432, -32.399, -0.415 ], "x_axis": [ 0.927, -0.252, 0.277 ], "y_axis": [ 0.326, 0.908, -0.265 ], "z_axis": [ -0.185, 0.336, 0.924 ], "quaternion": [ 0.969, -0.155, -0.119, -0.149 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": -119.127, "beta": -92.430, "gamma": -46.234, "delta": 146.264, "epsilon": -168.575, "zeta": -137.679, "epsilon_zeta": -30.896, "bb_type": "--", "chi": -113.449, "glyco_bond": "anti", "C5prime_xyz": [ -2.417, 8.408, -1.591 ], "P_xyz": [ -3.883, 10.568, -1.897 ], "form": ".", "ssZp": 2.491, "Dp": 2.397, "splay_angle": 24.177, "splay_distance": 3.935, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 81.711, "theta": 137.813, "eta_prime": 119.037, "theta_prime": 152.635, "eta_base": 139.827, "theta_base": -164.865, "v0": -30.956, "v1": 42.453, "v2": -37.227, "v3": 20.298, "v4": 6.269, "amplitude": 41.930, "phase_angle": 152.604, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 7.923, -15.536, 5.799 ], "x_axis": [ 0.680, -0.477, 0.557 ], "y_axis": [ 0.005, -0.757, -0.653 ], "z_axis": [ 0.733, 0.447, -0.512 ], "quaternion": [ -0.320, 0.859, -0.137, 0.376 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -50.395, "beta": 168.557, "gamma": 32.293, "delta": 94.256, "epsilon": -163.444, "zeta": -88.064, "epsilon_zeta": -75.380, "bb_type": "BI", "chi": -144.789, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.790, -0.396 ], "P_xyz": [ 1.039, 9.440, 0.037 ], "form": ".", "ssZp": 3.744, "Dp": 4.173, "splay_angle": 19.522, "splay_distance": 3.205, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 172.431, "theta": -154.165, "eta_prime": 170.458, "theta_prime": -146.539, "eta_base": -146.176, "theta_base": -134.533, "v0": -1.578, "v1": -18.774, "v2": 30.494, "v3": -32.000, "v4": 21.304, "amplitude": 32.673, "phase_angle": 21.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 10.172, -12.747, 4.172 ], "x_axis": [ 0.578, -0.814, 0.064 ], "y_axis": [ -0.484, -0.404, -0.776 ], "z_axis": [ 0.657, 0.418, -0.627 ], "quaternion": [ -0.369, 0.808, -0.402, 0.223 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": -36.706, "beta": 168.673, "gamma": 44.812, "delta": 143.278, "epsilon": -141.924, "zeta": 69.157, "epsilon_zeta": 148.919, "bb_type": "--", "chi": -111.779, "glyco_bond": "anti", "C5prime_xyz": [ -2.032, 8.417, -1.593 ], "P_xyz": [ 0.358, 9.324, -0.890 ], "form": ".", "ssZp": 1.424, "Dp": 1.586, "splay_angle": 150.992, "splay_distance": 18.648, "splay_ratio": 0.968, "d22": null, "d64": null, "eta": -174.615, "theta": 73.958, "eta_prime": -145.363, "theta_prime": 2.182, "eta_base": -132.874, "theta_base": -109.988, "v0": -19.987, "v1": 34.059, "v2": -34.748, "v3": 23.849, "v4": -2.601, "amplitude": 35.886, "phase_angle": 165.531, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.291, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 12.439, -10.961, 2.777 ], "x_axis": [ 0.168, -0.983, -0.073 ], "y_axis": [ -0.533, -0.028, -0.846 ], "z_axis": [ 0.829, 0.181, -0.529 ], "quaternion": [ -0.391, 0.657, -0.577, 0.288 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 125.095, "beta": 162.056, "gamma": -2.103, "delta": 145.528, "epsilon": -173.219, "zeta": 84.559, "epsilon_zeta": 102.222, "bb_type": "--", "chi": -104.997, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 7.942, -1.882 ], "P_xyz": [ 0.759, 9.184, -1.154 ], "form": ".", "ssZp": 1.955, "Dp": 2.172, "splay_angle": 73.028, "splay_distance": 11.031, "splay_ratio": 0.598, "d22": 8.155, "d64": 7.897, "eta": -45.550, "theta": 71.663, "eta_prime": 15.461, "theta_prime": 45.226, "eta_base": 127.120, "theta_base": 34.091, "v0": -4.651, "v1": 20.998, "v2": -28.255, "v3": 25.992, "v4": -13.594, "amplitude": 28.616, "phase_angle": 189.105, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 9.164, 0.055, -11.910 ], "x_axis": [ 0.950, 0.128, 0.284 ], "y_axis": [ -0.126, -0.673, 0.728 ], "z_axis": [ 0.285, -0.728, -0.624 ], "quaternion": [ 0.404, 0.901, 0.001, 0.158 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": 86.168, "beta": -150.157, "gamma": 172.635, "delta": 126.429, "epsilon": 70.811, "zeta": 55.484, "epsilon_zeta": 15.327, "bb_type": "--", "chi": -95.254, "glyco_bond": "anti", "C5prime_xyz": [ -2.282, 7.786, -2.449 ], "P_xyz": [ -1.062, 7.063, -4.683 ], "form": ".", "ssZp": 1.075, "Dp": 1.092, "splay_angle": 54.079, "splay_distance": 8.086, "splay_ratio": 0.455, "d22": null, "d64": null, "eta": -117.521, "theta": 123.670, "eta_prime": -161.056, "theta_prime": -173.010, "eta_base": -173.255, "theta_base": -88.506, "v0": -16.996, "v1": 24.870, "v2": -22.975, "v3": 13.559, "v4": 2.059, "amplitude": 25.004, "phase_angle": 156.759, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.002, "origin": [ 5.562, -2.448, -1.789 ], "x_axis": [ -0.346, 0.839, -0.421 ], "y_axis": [ -0.690, -0.532, -0.492 ], "z_axis": [ -0.636, 0.120, 0.762 ], "quaternion": [ 0.470, -0.325, -0.114, 0.812 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -121.653, "beta": -171.755, "gamma": 23.362, "delta": 135.448, "epsilon": -67.948, "zeta": 125.509, "epsilon_zeta": 166.544, "bb_type": "BII", "chi": 106.121, "glyco_bond": "--", "C5prime_xyz": [ -4.532, 6.122, 2.784 ], "P_xyz": [ -6.160, 4.530, 4.106 ], "form": ".", "ssZp": -0.771, "Dp": 0.758, "splay_angle": 153.353, "splay_distance": 18.872, "splay_ratio": 0.973, "d22": null, "d64": null, "eta": -175.313, "theta": 158.438, "eta_prime": -149.704, "theta_prime": 127.120, "eta_base": -75.500, "theta_base": 82.007, "v0": -36.485, "v1": 42.905, "v2": -32.657, "v3": 12.496, "v4": 14.776, "amplitude": 42.079, "phase_angle": 140.904, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -2.406, -3.240, -2.916 ], "x_axis": [ 0.257, 0.948, -0.188 ], "y_axis": [ 0.786, -0.093, 0.611 ], "z_axis": [ 0.562, -0.305, -0.769 ], "quaternion": [ 0.315, 0.728, 0.596, 0.128 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": 83.948, "beta": 148.830, "gamma": 58.867, "delta": 142.526, "epsilon": 175.443, "zeta": -100.010, "epsilon_zeta": -84.547, "bb_type": "BI", "chi": -130.592, "glyco_bond": "anti", "C5prime_xyz": [ -2.317, 8.768, -0.836 ], "P_xyz": [ 0.224, 9.436, -0.430 ], "form": ".", "ssZp": 1.987, "Dp": 2.296, "splay_angle": 22.345, "splay_distance": 3.739, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": -21.264, "theta": -122.941, "eta_prime": 14.776, "theta_prime": -148.666, "eta_base": 51.565, "theta_base": -127.570, "v0": -30.361, "v1": 41.179, "v2": -35.867, "v3": 19.376, "v4": 6.554, "amplitude": 40.626, "phase_angle": 151.990, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.057, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 9.478, -12.729, 8.257 ], "x_axis": [ -0.092, -0.840, -0.535 ], "y_axis": [ -0.763, 0.404, -0.504 ], "z_axis": [ 0.639, 0.362, -0.679 ], "quaternion": [ 0.398, -0.544, 0.737, -0.048 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -96.615, "beta": -139.308, "gamma": 54.699, "delta": 132.680, "epsilon": 161.616, "zeta": -84.590, "epsilon_zeta": -113.793, "bb_type": "BI", "chi": -98.038, "glyco_bond": "anti", "C5prime_xyz": [ -2.282, 8.019, -2.352 ], "P_xyz": [ -0.270, 9.618, -1.802 ], "form": "B", "ssZp": 1.716, "Dp": 1.952, "splay_angle": 20.119, "splay_distance": 3.428, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 166.104, "theta": -144.776, "eta_prime": -174.330, "theta_prime": -155.608, "eta_base": -142.061, "theta_base": -132.157, "v0": -22.104, "v1": 31.736, "v2": -29.127, "v3": 16.914, "v4": 3.085, "amplitude": 31.897, "phase_angle": 155.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 12.941, -12.081, 7.005 ], "x_axis": [ -0.502, -0.480, -0.719 ], "y_axis": [ -0.553, 0.818, -0.160 ], "z_axis": [ 0.665, 0.318, -0.676 ], "quaternion": [ 0.400, -0.298, 0.865, 0.046 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -79.970, "beta": -156.789, "gamma": 47.133, "delta": 142.777, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -90.950, "glyco_bond": "anti", "C5prime_xyz": [ -2.745, 7.784, -2.567 ], "P_xyz": [ -0.807, 9.585, -2.609 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -29.474, "v1": 39.987, "v2": -35.316, "v3": 19.045, "v4": 6.246, "amplitude": 39.826, "phase_angle": 152.466, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 15.716, -11.629, 5.042 ], "x_axis": [ -0.755, -0.105, -0.647 ], "y_axis": [ -0.220, 0.970, 0.100 ], "z_axis": [ 0.618, 0.217, -0.756 ], "quaternion": [ 0.339, -0.087, 0.933, 0.085 ] } } ], "num_hbonds": 27, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/1/N7", "atom2_id": "///A/19/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 14, "atom2_serNum": 396, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///A/1/O6", "atom2_id": "///A/19/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 15, "atom2_serNum": 141, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/1/N1", "atom2_id": "///A/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 17, "atom2_serNum": 138, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/1/N2", "atom2_id": "///A/7/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 33, "atom2_serNum": 420, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/2/N7", "atom2_id": "///A/20/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 36, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/2/O6", "atom2_id": "///A/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 37, "atom2_serNum": 163, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/2/N1", "atom2_id": "///A/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 39, "atom2_serNum": 160, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/2/N2", "atom2_id": "///A/8/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 44, "atom2_serNum": 503, "donAcc_type": "unknown", "distance": 2.893, "atom1_id": "///A/3/OP2", "atom2_id": "///A/104/NCE", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 10, "atom1_serNum": 55, "atom2_serNum": 442, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/3/N7", "atom2_id": "///A/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 58, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/3/O6", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 59, "atom2_serNum": 185, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/3/N1", "atom2_id": "///A/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 61, "atom2_serNum": 182, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/3/N2", "atom2_id": "///A/9/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 100, "atom2_serNum": 120, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/5/O4", "atom2_id": "///A/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 142, "atom2_serNum": 268, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/7/N1", "atom2_id": "///A/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 144, "atom2_serNum": 265, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/7/N2", "atom2_id": "///A/13/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 164, "atom2_serNum": 290, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/8/N1", "atom2_id": "///A/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 166, "atom2_serNum": 287, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/8/N2", "atom2_id": "///A/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 186, "atom2_serNum": 312, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/9/N1", "atom2_id": "///A/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 188, "atom2_serNum": 309, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/9/N2", "atom2_id": "///A/15/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 269, "atom2_serNum": 395, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/13/N1", "atom2_id": "///A/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 271, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/13/N2", "atom2_id": "///A/19/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 282, "atom2_serNum": 359, "donAcc_type": "questionable", "distance": 3.068, "atom1_id": "///A/14/O3'", "atom2_id": "///A/18/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 291, "atom2_serNum": 417, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/14/N1", "atom2_id": "///A/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 293, "atom2_serNum": 414, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/14/N2", "atom2_id": "///A/20/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 313, "atom2_serNum": 439, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/15/N1", "atom2_id": "///A/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 315, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/15/N2", "atom2_id": "///A/21/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4da3", "num_naChains": 1, "naChains": "A=21", "num_atoms": 532, "num_waters": 25, "num_metals": 3, "metals_desc": "K=3", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 10, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" } ], "time_used": "999" } }